rs73594411 chr16:53055283 C>A
- Sequence
gcagagcaccaggtcgctggcacg[C/A]tcgcatcctccccagccctcgcct
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.84 | 0.26 | 2.26 | |||
| foreskin keratinocyte | 1.60 | n/a | 3.00 |
Items per page:
1 – 2 of 2