rs73607005 chr19:55338697 A>G
- Sequence
gcgcatgtctgacagtgatcctat[A/G]tgtgtagacacacaagcgcctaca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) 22RV1 (prostate carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.09 | 1.22 | 2.80 | |||
| 22RV1 (prostate carcinoma) | 2.84 | n/a | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.83 | -1.78 | 1.00 |
Items per page:
1 – 3 of 3