rs73609833 chr10:28628314 C>T
- Sequence
tcgtgggccttcaacaccaggtgg[C/T]ggtgttgagctacattcagcaagc
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM19240 (B cells Lymphoblastoid Cell Lines) lymphoblastoid cells
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.39 | -1.52 | 1.47 | -4.21 | Concordant | |||
| STAG1_HUMAN | 1.13 | -1.61 | 1.42 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
