rs736158 chr6:42964016 G>A
- Sequence
catgccacaacaccagtagggggc[G/A]ggacatgctttattttcagccaca
- ASB in cell types
- THP-1 (acute monocytic leukemia) D54 (H54, Human glioblastoma) HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 0.03 | 1.15 | 2.00 | |||
| D54 (H54, Human glioblastoma) | n/a | 2.66 | 2.00 | |||
| HCT-116 (colon carcinoma) | 0.22 | 1.50 | 1.09 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid