rs736167 chr12:50283317 C>A
- Sequence
tatctcgagggggagggactcaca[C/A]tccttgcactccccccgccccaaa
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.20 | 0.94 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.79 | 0.12 | 2.00 | |||
| breast tumor | 2.40 | -1.43 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Brain_Cerebellum, Breast_Mammary_Tissue, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood