rs7361893 chr20:31612948 C>T
- Sequence
tgcaaacgcaggcgctgtgcccgc[C/T]cccgtcttcctttggccaccagcg
- ASB in cell types
- HepG2 (hepatoblastoma) Kelly (neuroblastoma) GM19193 (female B-cells Lymphoblastoid Cell Lines) SK-OV-3 (ovarian serous cystadenocarcinoma)
- ASB for transcription factors
- INT11_HUMAN ITF2_HUMAN STAG1_HUMAN SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| INT11_HUMAN | -0.04 | 1.91 | 3.00 | n/a | n/a | |||
| ITF2_HUMAN | 2.65 | -4.88 | 2.00 | n/a | No Hit | |||
| STAG1_HUMAN | 0.67 | 0.71 | 1.00 | n/a | n/a | |||
| SMC3_HUMAN | -0.00 | 0.95 | 2.29 | n/a | n/a | |||
| CTCF_HUMAN | 1.33 | 0.77 | 1.55 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Vagina, Whole_Blood