rs73622760 chr16:54244304 C>A
- Sequence
ttatcagaatccagaagagacagg[C/A]ggatagagggggccacctagagcc
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia) Jurkat (T-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLT-4 (Adult T acute lymphoblastic leukemia) | 1.34 | -0.23 | 1.00 | |||
| Jurkat (T-cells) | 1.31 | -0.56 | 1.00 |
Items per page:
1 – 2 of 2