rs73623567 chr9:128636239 G>C
- Sequence
gtgccctctgcagggcgggaagct[G/C]agtcctgagaggagaggaggcgga
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa S3 (cervical adenocarcinoma) | 0.49 | 1.29 | 3.64 | |||
| HeLa (cervical adenocarcinoma) | 0.53 | 1.66 | 3.12 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis