rs73625150 chr8:41622579 C>T
- Sequence
ttgtgcctgtggtgctgagtgtca[C/T]gtccccaaggtcgccctctggcct
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.06 | 1.05 | 1.17 | 0.31 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
