rs73644988 chr9:32552735 T>C
- Sequence
ttcccaccttagcaatggcaacgg[T/C]aacctgacgggggcgaggggaaat
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.05 | 1.56 | 1.08 | -0.31 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
