rs736510 chr14:100065147 G>T
- Sequence
gtggggggccagcaccatgacctg[G/T]cccctacctccagcaggcttcacc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MOLT-4 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.72 | 0.95 | 1.12 | |||
| MOLT-4 (Adult T acute lymphoblastic leukemia) | 1.35 | -0.16 | 1.13 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, microalbuminuria