rs73651343 chr9:92962041 T>C
- Sequence
cagcatttgatgatcactgggcca[T/C]tggggggcaggctgccaaaaacat
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM02630 (Fanconi anemi) GM02255 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -2.36 | 3.79 | 1.00 | 4.48 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
