rs73658319 chr9:114033574 C>T
- Sequence
cctgacgcctgcctcttccaggac[C/T]gcggcagagccctagaatgtccag
- ASB in cell types
- T47D (invasive ductal carcinoma) HeLa-Tet-On
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 0.50 | 1.18 | 1.02 | |||
| HeLa-Tet-On | -1.42 | 2.27 | 2.00 |
Items per page:
1 – 2 of 2