rs736813 chr21:38990002 G>A
- Sequence
gcctaatgaaaagcagcttgttca[G/A]agttagtcaaaggctttgggaatg
- ASB for transcription factors
- P63_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P63_HUMAN | 2.13 | -2.18 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, asthma, diastolic blood pressure (dbp), eye color, hdl cholesterol, hypertension (early onset hypertension), mitral annular calcium, schizophrenia, waist hip ratio