rs73690234 chr7:43071892 C>T
- Sequence
agggggcgctgttttgggggaagc[C/T]gcagtcagagctccctcagaggcc
- ASB in cell types
- T-ALL cells from peripheral blood
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T-ALL cells from peripheral blood | 2.17 | n/a | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Mucosa, Minor_Salivary_Gland, Ovary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Vagina