rs73698800 chr8:106285864 T>G
- Sequence
tctgtttttgagactgtacttctg[T/G]gaatgtgtgtctttatgcatcatt
- ASB in cell types
- MCF10A (breast epithelial cells)
- ASB for transcription factors
- STAT3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT3_HUMAN | 2.66 | -5.54 | 2.00 | 5.49 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
