rs737151 chr20:4760746 G>A
- Sequence
cgtccgggccacgagggggcgcgc[G/A]gacaccacccaccccgccgggcaa
- ASB in cell types
- erythroid cells neutrophils from periferal blood WA09 (embryonic stem cells) thoracic aorta
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | n/a | 2.30 | 2.00 | |||
| neutrophils from periferal blood | 1.39 | -1.50 | 1.50 | |||
| WA09 (embryonic stem cells) | 1.76 | 0.93 | 1.35 | |||
| thoracic aorta | -1.02 | 1.02 | 1.00 | |||
| upper lobe of left lung | 0.61 | -0.20 | 1.17 |
Items per page:
1 – 5 of 5