rs73716262 chr8:130802748 T>C
- Sequence
tgttcaagtgtcaacccttgtgtt[T/C]cttctccgctagatggtgtttttg
- ASB in cell types
- HeLa (cervical adenocarcinoma) GM18486 (Lymphoblastoid Cell Lines) HeLa S3 (cervical adenocarcinoma) HeLa Kyoto (cervical adenocarcinoma)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.01 | 1.28 | 2.08 | n/a | No Hit | |||
| STAG1_HUMAN | 2.13 | -1.89 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2