rs73716487 chr8:142634942 C>G
- Sequence
gtctgtgccacccacccatcggca[C/G]ggtccacacccggcagcacagccc
- ASB in cell types
- stomach gastrocnemius medialis
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| stomach | -2.41 | 2.72 | 1.00 | |||
| gastrocnemius medialis | 1.71 | -1.49 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Esophagus_Muscularis, Lung, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Thyroid