rs7371972 chr3:59709902 T>C
- Sequence
gtggcttgttctgcctgcagagca[T/C]tccacccagccccctccaggtccc
- ASB in cell types
- MDM(monocyte derived macrophages) CD34+ hematopoietic stem cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 2.08 | 0.35 | 2.00 | |||
| CD34+ hematopoietic stem cells | 2.60 | n/a | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), mitral annular calcium, obesity with early age of onset (age >2), systolic blood pressure (sbp), total cholesterol