rs7372004 chr3:42191345 G>A
- Sequence
gtgtggcgccctctagtggtatgc[G/A]tttttcaggttttcagctttgagt
- ASB in cell types
- 697 (B acute lymphoblastic leukemia with t(1;19)(q23;p13.3) E2A-PBX1 (TCF3-PBX1)) epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 697 (B acute lymphoblastic leukemia with t(1;19)(q23;p13.3) E2A-PBX1 (TCF3-PBX1)) | 1.52 | -0.84 | 1.00 | |||
| epidermal keratinocytes | n/a | 3.06 | 2.00 |
Items per page:
1 – 2 of 2