rs7373685 chr3:128388177 A>C
- Sequence
tctttccattgctcccgctcttag[A/C]gtcttcctttttttaatatccaat
- ASB in cell types
- THP-1 (acute monocytic leukemia) macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | -0.30 | 1.16 | 1.36 | |||
| macrophages form periferal blood | 1.59 | -0.03 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP nicotine dependence (smoking), smoking cessation in a trial of precessation nicotine replacement, transmission distortion
GTEx eQTL Adipose_Subcutaneous, Brain_Cortex, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood