rs73741949 chr5:23209048 T>C
- Sequence
gaaaatgaagctgggccttttaaa[T/C]gtctgtactttgctggctggcagg
- ASB in cell types
- CD34+ stem cells-derived erythroblasts GM19099 (female B-cells Lymphoblastoid Cell Lines) HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ stem cells-derived erythroblasts | 3.03 | -5.36 | 2.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -0.94 | 1.19 | 1.00 | |||
| HeLa (cervical adenocarcinoma) | 1.07 | n/a | 6.00 |
Items per page:
1 – 3 of 3