rs73745513 chr6:68196766 G>A
- Sequence
tcaggtcagaggtacctcctatag[G/A]aaaaaaaaaaaaaaaaaaagagca
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) GM18505 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | -2.19 | 2.52 | 1.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 2.40 | -2.08 | 1.00 |
Items per page:
1 – 2 of 2