rs7376483 chr4:7802538 C>T
- Sequence
acccctgttgggagttaaagacgg[C/T]agataaagagctgttaatatgaat
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) LUHMES (lund human mesencephalic cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | -0.92 | 1.43 | 1.00 | |||
| LUHMES (lund human mesencephalic cells) | -1.25 | 1.71 | 1.00 |
Items per page:
1 – 2 of 2