rs73777239 chr6:141677843 C>G
- Sequence
gaaaaggaaggaataaggacataa[C/G]attttttaaaatgtgaaaatgcca
- ASB in cell types
- GM02630 (Fanconi anemi) GM02255 (Lymphoblastoid Cell Lines) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02630 (Fanconi anemi) | -0.85 | 1.96 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | 1.73 | -2.24 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | 1.17 | -0.40 | 1.00 |
Items per page:
1 – 3 of 3