rs73778550 chr5:108521860 A>G
- Sequence
gcaggaatctttcagaattcttaa[A/G]agtatttttaatagctttgcgtga
- ASB in cell types
- foreskin keratinocyte GM19239 (male B-cells lymphoblastoid cell line) GM23338
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.54 | -2.25 | 1.94 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -0.31 | 1.06 | 1.00 | |||
| GM23338 | 1.97 | -1.63 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Whole_Blood