rs7377975 chr4:6198343 A>G
- Sequence
ggggaaaaagaagcatgtggggga[A/G]aaacccaagtgtgaagacatgtct
- ASB in cell types
- L1236 (Hodgkin lymphoma)
- ASB for transcription factors
- NFKB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFKB1_HUMAN | 2.71 | -1.91 | 2.00 | -1.96 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adiponectin levels, autism with high iq, hdl cholesterol, homa-ir, ldl cholesterol, total cholesterol, waist hip ratio