rs737826 chr22:20175098 G>A
- Sequence
atctgaccagcagggagagcccac[G/A]gagcgggagggcctgtggggctca
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | 2.66 | -1.84 | 1.33 | |||
| LNCaP (prostate carcinoma) | 1.55 | -0.86 | 1.00 |
Items per page:
1 – 2 of 2