rs73786645 chr6:165575042 G>T
- Sequence
tcataacttttgagtcaggtattt[G/T]ccctcaactgtacactgtggtcac
- ASB in cell types
- A549 (lung carcinoma) HT29 (colon adenocarcinoma) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- PPARG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PPARG_HUMAN | 1.37 | -4.08 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1