rs737869 chr22:19771914 G>C
- Sequence
tcgggcaacgctgggtgccagcat[G/C]ttgctctgggtgactttcttgcag
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.29 | 0.90 | 4.18 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, hdl cholesterol, parkinsons disease (pd) (age of onset), refractive error, rheumatoid arthritis
GTEx eQTL Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Pituitary, Prostate, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid