rs73794946 chr5:141619754 C>T
- Sequence
atgtgatagattctgctagcctca[C/T]cattttataaatagtaaatttgga
- ASB in cell types
- LNCaP C4-2B (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP C4-2B (prostate carcinoma) | -1.67 | 2.06 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Heart_Left_Ventricle, Lung, Pancreas, Prostate, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood