rs737982 chr7:156614530 A>G
- Sequence
gacactgctctaaatctttgtctg[A/G]tctcacaacaaggtgagtttcctt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ESR1_HUMAN GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.84 | 0.30 | 2.22 | n/a | No Hit | |||
| GATA3_HUMAN | 3.37 | -1.70 | 2.00 | -3.59 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP adiponectin levels, age at death with kuru exposure, fasting insulin, hiv-1 control (viral load at set point), ldl cholesterol, microalbuminuria, neuroticism, paternal transmission distortion, severe diabetic retinopathy, simpson-angus scale, total cholesterol