rs73798317 chr5:122547432 G>A
- Sequence
agtagatgaatgcaagacacatgc[G/A]ggtattgcatcaggaccaaattac
- ASB in cell types
- MSC (mesenchymal stem cells)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | -0.62 | 1.75 | 1.00 | 0.23 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
