rs737986 chr22:20021188 G>T
- Sequence
tccgctagtggcccggccggcctg[G/T]gctcgggggctccgggctctgggc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- E4F1_HUMAN ZN316_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| E4F1_HUMAN | n/a | 2.10 | 4.00 | n/a | No Hit | |||
| ZN316_HUMAN | -0.30 | 2.12 | 4.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Spleen