rs738077 chr22:20157290 G>T
- Sequence
tggcagggaaggggcagtgctagg[G/T]ggagccccctccccacttggatcc
- ASB in cell types
- K562 (myelogenous leukemia) hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.62 | 1.23 | 4.42 | |||
| hepatocytes | -0.85 | 1.51 | 1.00 |
Items per page:
1 – 2 of 2