rs73813583 chr3:13416636 T>C
- Sequence
cactttctccaagacagcgccccc[T/C]tgctggagcacccagaataccctg
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) GM18505 (female B-cells Lymphoblastoid Cell Lines) H929 (plasma cell myeloma) GM19238 (female B-cells lymphoblastoid cell lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.27 | -0.28 | 1.56 | -3.21 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood