rs738298 chr22:37512969 T>C
- Sequence
acacctgcctatgggaggtgggga[T/C]gcaagccgccaagccaggcacgat
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ESR1_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.30 | 0.82 | 1.00 | n/a | No Hit | |||
| ANDR_HUMAN | 2.61 | 0.56 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, refractive error
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Stomach