rs738435 chr22:29245750 G>A
- Sequence
catgatagtgcactgcaggaactg[G/A]agtgactgtgctgggcctgcccac
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line) hASC (preadipocytes) HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7L-P(immortalized breast epithelial cell line) | 1.06 | -0.18 | 1.50 | |||
| hASC (preadipocytes) | 1.86 | 0.25 | 1.00 | |||
| HeLa (cervical adenocarcinoma) | 0.86 | -2.84 | 2.00 |
Items per page:
1 – 3 of 3