rs738570 chr22:27498575 A>G
- Sequence
tcctacctcctggggctattgtaa[A/G]gactaaatgagtcggtgatcataa
- ASB in cell types
- iPS-derived chondrocytes
- ASB for transcription factors
- RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | 2.15 | -1.95 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP homa-b, irritible bowel syndrome, non-hodgkin lymphoma (chronic lymphocytic leukemia/small lymphocytic lymphoma), tetrology of fallot