rs7388447 chr8:119118324 C>T
- Sequence
agaagtgtgaaggggaagcaagca[C/T]cttcttcacatggtggagtgggag
- ASB in cell types
- TALL1 (T-Acute Lymphoblastic Leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TALL1 (T-Acute Lymphoblastic Leukemia) | -2.06 | 2.33 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Muscularis, Lung