rs739350 chr17:10117724 G>C
- Sequence
cagacccttcctgtgaaaacaaca[G/C]actagggaccagcagagcagccag
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM02255 (Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines) GM17942 (lymphoblastoid cell)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -0.60 | 1.21 | 1.14 | n/a | n/a |
Items per page:
1 – 1 of 1