rs7396059 chr11:970490 C>A
- Sequence
ttagcacctgctgccaacaccctg[C/A]gggcccccttcccgcccaagctgg
- ASB in cell types
- J-Lat A72
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | -0.94 | 1.56 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Pituitary, Skin_Sun_Exposed_Lower_leg