rs739752 chr7:20403005 T>G
- Sequence
atttgcattttagtaaataaatat[T/G]tgttaaattattgacgaatggaaa
- ASB in cell types
- foreskin keratinocyte bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -1.08 | 1.89 | 2.50 | |||
| bipolar neuron | -1.29 | 1.56 | 1.00 |
Items per page:
1 – 2 of 2