rs7403073 chr15:80567907 G>A
- Sequence
agctcttttttgaatttgtgaggc[G/A]aaactttgccagcagtaggcagac
- ASB in cell types
- A549 (lung carcinoma) GM02255 (Lymphoblastoid Cell Lines) foreskin keratinocyte RH4 (alveolar rhabdomyosarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.68 | 0.94 | 1.03 | |||
| GM02255 (Lymphoblastoid Cell Lines) | -0.65 | 2.03 | 1.00 | |||
| foreskin keratinocyte | -0.20 | 0.26 | 1.00 | |||
| RH4 (alveolar rhabdomyosarcoma) | 1.26 | -2.88 | 2.00 |
Items per page:
1 – 4 of 4