rs7404005 chr16:23853403 A>C
- Sequence
gagaaagcacactcatttcacaac[A/C]acttcagctggggaaggaagtcac
- ASB in cell types
- MDM(monocyte derived macrophages) GM12878 (female B-cells lymphoblastoid cell line) monocyte-derived dendritic cells macrophages
- ASB for transcription factors
- SPI1_HUMAN TF65_HUMAN IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -0.14 | 1.74 | 1.90 | n/a | No Hit | |||
| TF65_HUMAN | n/a | 3.56 | 2.00 | n/a | No Hit | |||
| IKZF1_HUMAN | -0.01 | 2.17 | 1.25 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP alcohol dependence without depressive symptoms, comorbid depressive syndrome and alcohol dependence, type 2 diabetes
GTEx eQTL Adipose_Subcutaneous, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood