rs7404786 chr16:10918693 G>C
- Sequence
gtgaaagaaactctgagcaagtca[G/C]ttattcattcctagccgctgtttt
- ASB in cell types
- foreskin keratinocyte GM12892 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -0.65 | 1.78 | 3.00 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | -0.55 | 0.65 | 1.00 |
Items per page:
1 – 2 of 2