rs7406119 chr17:83048753 C>T
- Sequence
agacctcaaacattcgtccagcca[C/T]ggttcagcgttgtggactgggagg
- ASB in cell types
- K562 (myelogenous leukemia) SUM159PT (Triple negative breast cancer)
- ASB for transcription factors
- SMAD3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMAD3_HUMAN | 1.88 | -1.61 | 1.00 | 0.95 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP crohns disease, combined control dataset, irritible bowel syndrome, neuroticism, transmission distortion, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Hippocampus, Brain_Hypothalamus, Brain_Spinal_cord_cervical_c-1, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Whole_Blood