rs740912 chr17:5809787 G>T
- Sequence
tggatgctaatccactgggctggt[G/T]cacacctaataaatcctcctgtct
- ASB in cell types
- WA01 (H1, human embryonic stem cells) iPS-derived dermal fibroblasts
- ASB for transcription factors
- CBX3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CBX3_HUMAN | 2.45 | -2.12 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1