rs741483 chr3:186185593 C>T
- Sequence
gtggggattcagctctgctcattc[C/T]cttctctgctctgagggagctaga
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | n/a | 2.63 | 2.00 | 0.35 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP age at death with kuru exposure, cystatin c in serum, hip bone mineral density (bmd), neuroblastoma (brain cancer), obesity with early age of onset (age >2), variant creutzfeldt-jakob disease, years of education